Browse by Type

Up a level
Export as [feed] Atom [feed] EPP RSS 2.0 [feed] RSS 1.0 [feed] RSS 2.0
Group by: Item Type | No Grouping
Jump to: Other
Number of items: 58.

Other

Catur, Herison (2019) Hasil Cedk Ithenticate : Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : EVALUATION OF GROWTH AND YIELD PERFORMANCE ON INOCULATED CHILI PEPPER HYBRIDS BY CUCUMBER MOSAIC VIRUS. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Growth And Yield Of Six Newly Developed Chili Pepper Hybrids At Medium Elevation In Wet Season. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Hematoxylin Root Stain as an Indicator for Al Toxicity Tolerance in F5 Generation from a Cross Between Local Rainfed Rice “Pendek” and IR 78581. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Wet Season Trials on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Dwi, Wahyuni Ganefianti and Fahrurrozi, Fahrurrozi and Yukiman, Armadi and Helfi, Eka Saputra (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI DWIGUNA UNIB. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and SRI, HEDRASTUTI HIDAYAT and Muhamad, Syukur and SRIANI, SUJIPRIHATI (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH 43. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Sri, Hendrastuti Hidayat and Mohamad, Syukur and Yukiman, Armadi (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH13. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Puji, Harsono and Mimi, Sutrawati and Helfi, Eka Saputra (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH23. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Sri Hendrastuti, Hidayat and Muhamad, Syukur and Fahrurrozi, Fahrurrozi and Atra, Romeida (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH73. Kementerian Pertanian RI.

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas Unib CHR23. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Jagung hasil Pemuliaan Tanaman: Varietas Jagung Unib CT30. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas MAXIMA. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas Unib CHR17 F1. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Daya Gabung dan Heterobeltiois Karakter Pertumbuhan dan Hasil beberapa Galur Backcross Cabai Merah Toleran CMV pada Kondisi Terinokulasi. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Pendugaan Keragaman Genetik Beberapa Karakter Pertumbuhan dan Hasil pada 30 Genotipe Tomat Lokal. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Wet Season Trials on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prensentasi yang tidak dimuat prosiding: Wet Season Trial on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review presentasi tidak dimuat prosiding: Aluminium Tolerance Chili Pepper Genotypes Selected at Early Growth Stage Confirm Their Field Performance in Acidic Soil. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review presentasi yang tidak dimuat di prosiding: Respon Pertumbuhan Awal Sepuluh Genotipe Cabe Merah terhadap Peningkatan Cekaman ALumunium pada Kultur Hara. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prosiding: Growth and Yield of Six Newly Developed Chili Pepper Hybrids At Medium Elevation in Wet Season. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prosiding: Hematoxylin Root Stain as an Indicator for Al Toxicity Tolerance in F5 Generation from a Cross Between Local Rainfed Rice “Pendek” and IR78581. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review: Evaluation of Growth and Yield Performance on Inoculated Chili Pepper Hybrids by Cucumber Mosaic Virus. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil review sejawat artikel jurnal: Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Peer Review artikel jurnal: Peningkatan Adaptibilitas Gembili (Dioscorea esculenta L.) pada Lahan Pesisir dengan Penambahan Pupuk Amonium Sulfat (ZA) dan Mulsa Organik. Universitas Bengkulu. (Unpublished)

Marulak, Simarmata and Muhammad, Faiz Barchia and Santo Nicolas, Simatupang (2017) Prospect for Growing Sorghum (Sorghum bicolor L. Moench) at Marginal Dry Land in Coastal Area Retrieved with Organic Soil Amendments. Asian Journal Of Crop Science.

Marulak, Simarmata and Puji, Harsono and H., Hartal (2017) Sensitivity of Legumes and Soil Microorganism to Residue of Herbicide Mixture of Atrazine and Mesotrione. Asian Journal of Agriculture and Biology.

Dahwal, Sirman (2016) HAK-HAK DAN KEWAJIBAN WARGA NEGARA MENURUT KONSTITUSI UUD NRI TAHUN 1945. Fakultas Hukum Universitas Bengkulu, Universitas Bengkulu.

Satmaidi, Endra (2016) MEMFUNGSIKAN IZIN LINGKUNGAN DALAM MEWUJUDKAN PEMBANGUNAN BERKELANJUTAN. Program Studi Pascasarjana Ilmu Hukum, Fakultas Hukum UNIB, Bengkulu.

Dahwal, Sirman (2016) PANCASILA SEBAGAI DASAR NEGARA, IDEOLOGI NEGARA, DAN SUMBER NILAI KEBANGSAAN INDONESIA. Fakultas Hukum Universitas Bengkulu, Universitas Bengkulu.

Satmaidi, Endra (2016) PENATAAN KEWENANGAN MAHKAMAH KONSTITUSI DAN MAHKAMAH AGUNG DALAM PENGUJIAN PERATURAN PERUNDANG-UNDANGAN. Program Studi Pascasarjana Ilmu Hukum, Fakultas Hukum UNIB, Universitas Bengkulu.

Meiliani, Meiliani (2015) IMPROVING HUMAN RECOURCE MANAGEMENT UNDER REGIONAL AUTONOMY. Policy Research Forum, Jakarta.

Ruyani, Aceng (2011) PETANDA OLIGONULEOTIDA (ACTTAATTGGGAGCCATATA) BERLABEL BIOTIN UNTUK DETEKSI DINI KELAINAN GENETIK SPINDYLO-EPIPHYSEAL DYSPLASIA TARDA (SEDT) DI BENGKULU. Universitas Bengkulu, Bengkulu.

Chozin, Mohammad and Silalahi, Sarina and Masdar, Masdar and Sumardi, Sumardi Agronomic Performances of Rice Lines on Non-Tidal Swampland. Jurnal Akta Agrosia.

Chozin, M. and Sudjatmiko, Sigit and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Analysis of traits association in sweet corn inbred lines as grown under organic cropping system. Sabrao Journal of Breeding and Genetics.

Chozin, M. and Sumardi, Sumardi Assessment of Variability in Performances of F3 Rice Populations on Inland Swampland in Indonesia”. Asian Journal of Agriculture and Biology.

Sudjatmiko, Sigit and Muktamar, Zainal and Chozin, Mohammad and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Changes in chemical properties of soil in an organic agriculture system. IOP Conference Series: Earth and Environmental Science.

Chozin, M. and Sudjatmiko, Sigit Combining ability analysis of ear characteristics of sweet corn hybrids suitable for organic crop production. Journal of Horticultural Research.

Fahrurrozi, Fahrurrozi and Muktamar, Zainal and Setyowati, Nanik and Sudjatmiko, Sigit and Chozin, Mohammad Comparative effects of soil and foliar applications of tithonia-enriched liquid organic fertilizer on yields of sweet corn in closed agriculture production system. Agrivita.

Chozin, M. and Sigit, Sudjatmiko and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Daya gabung karakteristik tongkol dari galur-galur inbrida jagung manis pada system budidaya organik. Jurnal Hortikulura Indonesia.

Chozin, M. and Sumardi, Sumardi and Sudjatmiko, Sigit Empowering smallholder farmers to gain more profitable rice production. Asian Journal For Poverty.

sianturi, s and Muktamar, Zainal and Chozin, Mohammad Enhancing Soil Chemical Properties and Sweet Corn Growth by Solid Organic Amendments in Ultisol. Jurnal TERRA.

Chozin, M. and Sudjatmiko, Sigit and Muktamar, Zainal and Setyowati, Nanik and Fahrurrozi, Fahrurrozi Evaluasi variabilitas komponen hasil dan hasil jagung manis generasi S5 untuk pengembangan varietas yang beradaptasi pada sistem budidaya organik. Prosiding Seminar Nasional Perhimpunan Pemuliaan Indonesia (PERIPI) Komda Riau.

Chozin, Mohammad and Sumardi, Sumardi and Sudjatmiko, Sigit and Faiz, Barchia Genetic variability and traits association analyses on F2 generations for determination of selection criteria in Indonesian inland swamp rice breeding. Australian Journal of Crop Science.

sridanti, irma lisa and Herison, Catur and Chozin, Mohammad Growth Analysis of Seven Genotypes Chili Pepper Plant (Capsicum Annuum L.) in Plain Medium. Proceeding: International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone, Faculty of Agriculture, University of Bengkulu.

Chozin, Mohammad and Marwanto, Marwanto and Sudjatmiko, Sigit Growth, Yield Components, and Yield Associations in Rice Grown on Lowland Swamp. Proceeding International Seminar and Expo on Promoting Local Resources For Food And Health.

Lorenza, Eviya and Chozin, M. and Nanik, Setyowati Hubungan antar sifat jagung manis yang dibudidayakan secara organik. Akta Agrosia.

Chozin, M. and Sudjatmiko, Sigit and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Muktamar, Zainal Hybrid Performances and Heterosis in Sweet Corn As Grown Under Organic Crop Management in Tropical Highland Climate. International Journal of Agricultural Technology.

Chozin, Mohammad and Pujiwati, Hesti and Rustikawati, Rustikawati and Sumardi, Sumardi Optimization of PCR Protocol and Primers Screening for Development of Rapid Marker Associated with Submergence Tolerance in Rice Genotypes. Proceeding: International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone, Faculty of Agriculture, University of Bengkulu.

Daryono, Daryono PENGANTAR OTOMASI PERPUSTAKAAN. UPT Perpustakaan, Bengkulu.

Sumardi, Sumardi and Chozin, M. and Hermansyah, Hermansyah Penampilan Ratun dari Galur-Galur Padi keturunan Varietas Lokal Bengkulu pada Lahan Rawa Lebak. Jurnal Lahan Suboptimal.

Sela, Tita Marta and Chozin, M. and Usman, Kris Joko Suharjo and Nanik, Setyowati Pengujian 13 jagung manis hibrida di ultisol. Agrin.

Sela, Tita Marta and Chozin, Mohammad and Usman, Kris Joko Suharjo and Setyowati, Nanik Pengujian 13 jagung manis hibrida di ultisol. Similarity Check.

Chozin, M. and Sudjatmiko, Sigit Performances of sweet corn hybrids under organic crop management across three agro-climatic zones of the tropics. International Journal of Agricultural Technology.

Zainal, Muktamar and Sigit, Sudjatmiko Soil chemical improvement under application of liquid organic fertilizer in closed agriculture system. International Journal of Agricultural Technology.

Muktamar, Zainal and Sudjatmiko, Sigit and Chozin, M. and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Sweet corn performance and its major nutrient uptake following application of vermicompost supplemented with liquid organic fertilizer. International Journal on Advance Science Engineering Information Technology.

Chozin, Mohammad and Sudjatmiko, Sigit and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Muktamar, Zainal Variability in growth and yield among sweet corn genotypes grown under organic crop management. IOP Conference Series: Earth and Environmental Science.

Chozin, Mohammad and Hartal, Hartal and guspitasari, y and Sudjatmiko, Sigit The potential use of plant extracts for controlling northern leaf blight on organic sweet corn production. IOP Conference Series: Earth and Environmental Science.

This list was generated on Sat Jul 11 23:12:26 2020 WIB.