Browse by Type

Up a level
Export as [feed] Atom [feed] EPP RSS 2.0 [feed] RSS 1.0 [feed] RSS 2.0
Group by: Item Type | No Grouping
Jump to: Other
Number of items: 310.

Other

Yudha S, Sal Prima (2021) [Korespondensi] Gold and Gold-Palladium/(1-Vinyl-Pyrolidinone)-as Quasi Homogeneous Catalyst for Oxidation of Glycerol – TETRAHEDRON LETTERS (2011). ELSEVIER. (Unpublished)

Yudha S, Sal Prima (2021) [Korespondensi] In Situ Preparation of Gold–Silica Particles from a Mixture of Oil Palm Leaves and Chloroauric Acid for Reduction of Nitroaromatic Compounds in Water – Jurnal: WASTE AND BIOMASS VALORIZATION (2020). SPRINGER. (Unpublished)

Yudha S, Sal Prima (2021) [Korespondensi] In situ dispersion and antibacterial properties of green-synthesized metallic gold on corn husk cellulose biofilms – Jurnal: CHEMICAL PAPERS (2020). SPRINGER. (Unpublished)

Yudha S, Sal Prima (2021) [Korespondensi] Preliminary Synthesis of Calcium Silicates using Oil Palm Leaves and Eggshells – Jurnal: BULLETIN OF CHEMICAL REACTION ENGINEERING & CATALYSIS (2020). Department of Chemical Engineering, Diponegoro University. (Unpublished)

Yudha S, Sal Prima (2021) [Korespondensi] Utilization of Dammar-Gum as a Soft Template in Titania Synthesis for Photocatalyst – Jurnal: INTERNATIONAL JOURNAL OF TECHNOLOGY (2020). Faculty of Engineering, Universitas Indonesia.. (Unpublished)

Yudha S, Sal Prima (2021) [Korespondensi]A SEM study of unexplored wax microtubes produced by caterpillar living on common banana leaves – Jurnal: MICRON (2019). ELSEVIER. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] A SEM study of unexplored wax microtubes produced by caterpillar living on common banana leaves – Jurnal: MICRON (2019). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Aerobic oxidation of hydroxylamines with nanoporous gold catalyst as an efficient synthetic method of nitrones – Jurnal: TETRAHEDRON (2015). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Antileukemic activity of lignans and phenylpropanoids of Cinnamomum parthenoxylon – Jurnal: Bioorganic & Medicinal Chemistry Letters. Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Application of Metal‐Based Reagents and Catalysts in Microstructured Flow Devices – Jurnal: ChemSusChem (2012). Wiley and Son, Inc.. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Biosynthesis of gold nanoparticles: A green approach – Jurnal: Journal of Photochemistry and Photobiology B: Biology (2016). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Chemical components, antitermite and antifungal activities of Cinnamomum parthenoxylon wood vinegar – Jurnal: Journal of Korean Wood Science and Technology (2020). The Korean Society of Wood Science & Technology. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Eco-friendly Coating of Natural Zeolite with Metallic Gold, and Characterization of the Resulting Products – Jurnal: Oriental Journal of Chemistry (2018). Oriental Scientific Publishing Company. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Ekstrak bunga tapak kuda (Ipomoea pescaprae L. Sweet) sebagai medium sintesis nanopartikel emas – Jurnal: Jurnal Kimia dan Kemasan (2020). Kementerian Perindustrian Republik Indonesia. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Fabrication of ZnAl2O4 from corresponding metals nitrate in the co-existence of natural SiO2 and it application as adsorbent of mercury nitrate - AIP Conference Proceedings (2017). AIP Publishing LLC. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Gold and Gold-Palladium/(1-Vinyl-Pyrolidinone)-as Quasi Homogeneous Catalyst for Oxidation of Glycerol – TETRAHEDRON LETTERS. Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] In Situ Preparation of Gold–Silica Particles from a Mixture of Oil Palm Leaves and Chloroauric Acid for Reduction of Nitroaromatic Compounds in Water – Jurnal: WASTE AND BIOMASS VALORIZATION. Springer. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] In situ dispersion and antibacterial properties of green-synthesized metallic gold on corn husk cellulose biofilms – Jurnal: CHEMICAL PAPERS (2020). Springer. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Iron chelating and antiradical activity of kayu manik leaves (Trema orientalis) – Jurnal: Indonesian Journal of Chemistry (2011). Gadjah Mada University. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Iron sand - ZnO based materials of natural origin for dye decolorization under sunlight irradiation - AIP Conference Proceedings (2017). AIP Publishing LLC. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Melastoma malabathricum fruit extract-mediated synthesis of silver nanoparticles with sensing ability for high concentrations of mercury (II) nitrate – Jurnal: Journal of Pure and Applied Chemistry Research (2017). Department of Chemistry, Brawijaya University. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Melastoma malabathricum fruit extract-mediated synthesis of silver nanoparticles with sensing ability for high concentrations of mercury (II) nitrate – Jurnal: Journal of Pure and Applied Chemistry Research (2019). Department of Chemistry, Brawijaya University. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Preliminary Synthesis of Calcium Silicates using Oil Palm Leaves and Eggshells – Jurnal: BULLETIN OF CHEMICAL REACTION ENGINEERING & CATALYSIS (BCREC). Department of Chemical Engineering, Diponegoro University. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Preparasi Serat Arang dari Rambut Jagung Menggunakan Aluminium-Hotplate – HaKI: Hak Cipta (2020). Kementerian Hukum dan Hak Azasi Manusia (HAM). (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Preparation of Cyperus diffusus Vahl cellulose–polyanniline composite for dye removal – Prosiding: IOP Conf. Series: Materials Science and Engineering (2020). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Preparation and characterization of cellulose biofilm from coastal pandanus (Pandanus odorifer) leaves – Prosiding: IOP Conf. Series: Materials Science and Engineering (2019). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Preparation of Silver-Incorporated Rhynchospora corymbosa (L.) Cellulose via in-situ Green Reduction and Its Antibacterial Study – Prosiding: IOP Conf. Series: Materials Science and Engineering (2020). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Production of gold nanoparticles (AuNPs) from chloroaurate ions using aqueous extract of air-dried Premna obtusifulia Leaves – Jurnal: Research Journal for Pharmaceutical, Biological and Chemical Sciences (2016). RJPBCS. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] The Scaevola frutescen (Mill.) Krause dried-leaves extract as a potential natural reduction system for synthesis of gold nanoparticles and their evaluation for antibacterial of Eschericia coli - AIP Conference Proceedings (2016). AIP Publishing LLC. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] The utility of aqueous extract of air-dried Callophyllum inophyllum L. leaf as medium/reduction system for synthesis of gold nanoparticles (AuNPs) – Prosiding: Proceedings of The 9th Joint Conference on Chemistry (2015). UNDIP, UNNES, UNS, UNSOED. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Use of Aqueous Extract of Pseuderanthemum acuminatissimum Radlk Leaves To Mediate the Synthesis of Gold Nanoparticles and Their Anti Eschericia coli Activity – Jurnal: Oriental Journal of Chemistry (2017). Oriental Scientific Publishing Company. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] Utilization of Dammar-Gum as a Soft Template in Titania Synthesis for Photocatalyst – Jurnal: INTERNATIONAL JOURNAL OF TECHNOLOGY (IJTECH). Faculty of Engineering, Universitas Indonesia.. (Unpublished)

Yudha S, Sal Prima (2021) [P-R] ZnO-SiO2 and Zn2SiO4 Synthesis utilizing oil palm leaves for degradation of methylene blue dye in aqueous solution – Jurnal: The Journal of the Indonesian Chemical Society (2020). The Indonesian Chemical Society. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] A SEM study of unexplored wax microtubes produced by caterpillar living on common banana leaves – Jurnal: MICRON (2019). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Aerobic oxidation of hydroxylamines with nanoporous gold catalyst as an efficient synthetic method of nitrones – Jurnal: TETRAHEDRON (2015). Elsevier. (Unpublished)

Morina, Adfa and Yudha S, Sal Prima (2021) [S-C] Antileukemic activity of lignans and phenylpropanoids of Cinnamomum parthenoxylon – Jurnal: Bioorganic & Medicinal Chemistry Letters (2016). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Application of Metal‐Based Reagents and Catalysts in Microstructured Flow Devices – Jurnal: CHEMSUSCHEM (2012). Wiley and Son, Inc.. (Unpublished)

Morina, Adfa and Yudha S, Sal Prima (2021) [S-C] Chemical components, antitermite and antifungal activities of Cinnamomum parthenoxylon wood vinegar – Jurnal: Journal of Korean Wood Science and Technology (2020). The Korean Society of Wood Science & Technology. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Eco-friendly Coating of Natural Zeolite with Metallic Gold, and Characterization of the Resulting Products – Jurnal: ORIENTAL JOURNAL OF CHEMISTRY (2018). Oriental Scientific Publishing Company. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Ekstrak bunga tapak kuda (Ipomoea pescaprae L. Sweet) sebagai medium sintesis nanopartikel emas – Jurnal: Jurnal Kimia dan Kemasan (2020). Kementerian Perindustrian Republik Indonesia. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Garcinia Mangostana peel extract as sustainable fuel source on ceria synthesis under hydrothermal condition – Jurnal: Journal of Pure and Applied Chemistry Research (2019). Department of Chemistry, Brawijaya University. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Gold and Gold-Palladium/1-Vinyl-Pyrolidinone)-as Quasi Homogeneous Catalyst for Oxidation of Glycerol – TETRAHEDRON LETTERS (2011). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Green Synthesis of Biosynthesis of gold nanoparticles: A green approach – Jurnal: Journal of Photochemistry and Photobiology B: Biology (2016). Elsevier. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] In Situ Preparation of Gold–Silica Particles from a Mixture of Oil Palm Leaves and Chloroauric Acid for Reduction of Nitroaromatic Compounds in Water – Jurnal: WASTE AND BIOMASS VALORIZATION (2020). Springer. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] In situ dispersion and antibacterial properties of green-synthesized metallic gold on corn husk cellulose biofilms – Jurnal: CHEMICAL PAPERS. Springer. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Iron chelating and antiradical activity of kayu manik leaves (Trema orientalis) – Jurnal: Indonesian Journal of Chemistry (2011). Gadjah Mada University. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Iron sand - ZnO based materials of natural origin for dye decolorization under sunlight irradiation - AIP Conference Proceedings (2017). AIP Publishing LLC. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Melastoma malabathricum fruit extract-mediated synthesis of silver nanoparticles with sensing ability for high concentrations of mercury (II) nitrate – Jurnal: Journal of Pure and Applied Chemistry Research (2017). Department of Chemistry, Brawijaya University. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Preliminary Synthesis of Calcium Silicates using Oil Palm Leaves and Eggshells – Jurnal: BULLETIN OF CHEMICAL REACTION ENGINEERING & CATALYSIS (2020). Department of Chemical Engineering, Diponegoro University. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Preparasi Serat Arang dari Rambut Jagung Menggunakan Aluminium-Hotplate – Bentuk HaKI: HAK CIPTA (2020). Kementerian Hukum dan Hak Azasi Manusia (HAM). (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Preparation of Cyperus diffusus Vahl cellulose–polyanniline composite for dye removal – Prosiding: IOP Conf. Series: Materials Science and Engineering (2020). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Preparation and characterization of cellulose biofilm from coastal pandanus(Pandanus odorifer) leaves – Prosiding: IOP Conf. Series: Materials Science and Engineering (2019). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Preparation of Silver-Incorporated Rhynchospora corymbosa (L.) Cellulose via in-situ Green Reduction and Its Antibacterial Study – Prosiding: IOP Conf. Series: Materials Science and Engineering (2020). IOP Publishing. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Production of gold nanoparticles (AuNPs) from chloroaurate ions using aqueous extract of air-dried Premna obtusifulia Leaves – Jurnal: Research Journal for Pharmaceutical, Biological and Chemical Sciences (2015). RJPBCS. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] The Scaevola frutescen (Mill.) Krause dried-leaves extract as a potential natural reduction system for synthesis of gold nanoparticles and their evaluation for antibacterial of Eschericia coli - AIP Conference Proceedings (2016). AIP Publishing LLC. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] The utility of aqueous extract of air-dried Callophyllum inophyllum L. leaf as medium/reduction system for synthesis of gold nanoparticles (AuNPs) – Prosiding: Proceedings of The 9th Joint Conference on Chemistry (2015). UNDIP, UNNES, UNS, UNSOED. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Use of Aqueous Extract of Pseuderanthemum acuminatissimum Radlk Leaves To Mediate the Synthesis of Gold Nanoparticles and Their Anti Eschericia coli Activity – Jurnal: ORIENTAL JOURNAL OF CHEMISTRY (2017). Oriental Scientific Publishing Company. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] Utilization of Dammar-Gum as a Soft Template in Titania Synthesis for Photocatalyst – Jurnal: INTERNATIONAL JOURNAL OF TECHNOLOGY (2020). Faculty of Engineering, Universitas Indonesia.. (Unpublished)

Yudha S, Sal Prima (2021) [S-C] ZnO-SiO2 and Zn2SiO4 Synthesis utilizing oil palm leaves for degradation of methylene blue dye in aqueous solution – Jurnal: The Journal of the Indonesian Chemical Society (JICS) (2020). The Indonesian Chemical Society. (Unpublished)

Martono, Agus and Yudha S, Sal Prima (2021) [S-C]Fabrication of ZnAl2O4 from corresponding metals nitrate in the co-existence of natural SiO2 and it application as adsorbent of mercury nitrate - AIP Conference Proceedings (2017). AIP Publishing LLC. (Unpublished)

Catur, Herison (2019) Hasil Cedk Ithenticate : Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : EVALUATION OF GROWTH AND YIELD PERFORMANCE ON INOCULATED CHILI PEPPER HYBRIDS BY CUCUMBER MOSAIC VIRUS. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Growth And Yield Of Six Newly Developed Chili Pepper Hybrids At Medium Elevation In Wet Season. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Hematoxylin Root Stain as an Indicator for Al Toxicity Tolerance in F5 Generation from a Cross Between Local Rainfed Rice “Pendek” and IR 78581. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil Cek Ithenticate : Wet Season Trials on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Dwi, Wahyuni Ganefianti and Fahrurrozi, Fahrurrozi and Yukiman, Armadi and Helfi, Eka Saputra (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI DWIGUNA UNIB. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and SRI, HEDRASTUTI HIDAYAT and Muhamad, Syukur and SRIANI, SUJIPRIHATI (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH 43. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Sri, Hendrastuti Hidayat and Mohamad, Syukur and Yukiman, Armadi (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH13. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Puji, Harsono and Mimi, Sutrawati and Helfi, Eka Saputra (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH23. Kementerian Pertanian RI.

Dwi, Wahyuni Ganefianti and Sri Hendrastuti, Hidayat and Muhamad, Syukur and Fahrurrozi, Fahrurrozi and Atra, Romeida (2019) TANDA DAFTAR VARIETAS HASIL PEMULIAAN CABAI UNIB CH73. Kementerian Pertanian RI.

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas Unib CHR23. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Jagung hasil Pemuliaan Tanaman: Varietas Jagung Unib CT30. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas MAXIMA. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review Karya Teknologi yang tidak dipatenkan: Perakitan Varietas Cabai Merah hasil Pemuliaan Tanaman: Varietas Unib CHR17 F1. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Daya Gabung dan Heterobeltiois Karakter Pertumbuhan dan Hasil beberapa Galur Backcross Cabai Merah Toleran CMV pada Kondisi Terinokulasi. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Pendugaan Keragaman Genetik Beberapa Karakter Pertumbuhan dan Hasil pada 30 Genotipe Tomat Lokal. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review artikel jurnal: Wet Season Trials on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prensentasi yang tidak dimuat prosiding: Wet Season Trial on Growth and Yield of Six Newly Developed Chili Pepper Hybrids at Three Different Locations. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review presentasi tidak dimuat prosiding: Aluminium Tolerance Chili Pepper Genotypes Selected at Early Growth Stage Confirm Their Field Performance in Acidic Soil. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review presentasi yang tidak dimuat di prosiding: Respon Pertumbuhan Awal Sepuluh Genotipe Cabe Merah terhadap Peningkatan Cekaman ALumunium pada Kultur Hara. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prosiding: Growth and Yield of Six Newly Developed Chili Pepper Hybrids At Medium Elevation in Wet Season. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review prosiding: Hematoxylin Root Stain as an Indicator for Al Toxicity Tolerance in F5 Generation from a Cross Between Local Rainfed Rice “Pendek” and IR78581. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil peer review: Evaluation of Growth and Yield Performance on Inoculated Chili Pepper Hybrids by Cucumber Mosaic Virus. Universitas Bengkulu. (Unpublished)

Catur, Herison (2019) Hasil review sejawat artikel jurnal: Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers. Universitas Bengkulu. (Unpublished)

Yudha S, Sal Prima (2019) Kualitas Jurnal dan Bukti Korespondensi Publikasi Ilmiah di Micron(Syarat Khusus 2). Elsevier. (Unpublished)

Yudha S, Sal Prima (2019) Kualitas Jurnal dan Bukti Korespondensi Publikasi di Chemical Papers (Syarat Khusus 1). Springer. (Unpublished)

Catur, Herison (2019) Peer Review artikel jurnal: Peningkatan Adaptibilitas Gembili (Dioscorea esculenta L.) pada Lahan Pesisir dengan Penambahan Pupuk Amonium Sulfat (ZA) dan Mulsa Organik. Universitas Bengkulu. (Unpublished)

Chozin, Mohammad (2017) CERTIFICATE as Presenter "The potential use of plant extracts for controlling northern leaf blight on organic sweet corn production". Orgatrop.

Marulak, Simarmata and Muhammad, Faiz Barchia and Santo Nicolas, Simatupang (2017) Prospect for Growing Sorghum (Sorghum bicolor L. Moench) at Marginal Dry Land in Coastal Area Retrieved with Organic Soil Amendments. Asian Journal Of Crop Science.

Marulak, Simarmata and Puji, Harsono and H., Hartal (2017) Sensitivity of Legumes and Soil Microorganism to Residue of Herbicide Mixture of Atrazine and Mesotrione. Asian Journal of Agriculture and Biology.

Dahwal, Sirman (2016) HAK-HAK DAN KEWAJIBAN WARGA NEGARA MENURUT KONSTITUSI UUD NRI TAHUN 1945. Fakultas Hukum Universitas Bengkulu, Universitas Bengkulu.

Satmaidi, Endra (2016) MEMFUNGSIKAN IZIN LINGKUNGAN DALAM MEWUJUDKAN PEMBANGUNAN BERKELANJUTAN. Program Studi Pascasarjana Ilmu Hukum, Fakultas Hukum UNIB, Bengkulu.

Dahwal, Sirman (2016) PANCASILA SEBAGAI DASAR NEGARA, IDEOLOGI NEGARA, DAN SUMBER NILAI KEBANGSAAN INDONESIA. Fakultas Hukum Universitas Bengkulu, Universitas Bengkulu.

Satmaidi, Endra (2016) PENATAAN KEWENANGAN MAHKAMAH KONSTITUSI DAN MAHKAMAH AGUNG DALAM PENGUJIAN PERATURAN PERUNDANG-UNDANGAN. Program Studi Pascasarjana Ilmu Hukum, Fakultas Hukum UNIB, Universitas Bengkulu.

Meiliani, Meiliani (2015) IMPROVING HUMAN RECOURCE MANAGEMENT UNDER REGIONAL AUTONOMY. Policy Research Forum, Jakarta.

Ruyani, Aceng (2011) PETANDA OLIGONULEOTIDA (ACTTAATTGGGAGCCATATA) BERLABEL BIOTIN UNTUK DETEKSI DINI KELAINAN GENETIK SPINDYLO-EPIPHYSEAL DYSPLASIA TARDA (SEDT) DI BENGKULU. Universitas Bengkulu, Bengkulu.

Faiz, Barchia Agroekosistem Tanah Mineral Masam. GADJAH MADA UNIVERSITY PRESS.

Chozin, Mohammad and Silalahi, Sarina and Masdar, Masdar and Sumardi, Sumardi Agronomic Performances of Rice Lines on Non-Tidal Swampland. Jurnal Akta Agrosia.

Khairul, Amri and Faiz, Barchia and Yuzuar, Afrizal Analysis of erosion hazardous level and sedimentation in Manna Watershed, Bengkulu Province Indonesia. SICEST.

Khairul, Amri and Faiz, Barchia and Yuzuar, Afrizal Analysis of erosion hazardous level and sedimentation in Manna Watershed, Bengkulu Province Indonesia. International Conference on Engineering, Science and Technology.

Chozin, M. and Sudjatmiko, Sigit and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Analysis of traits association in sweet corn inbred lines as grown under organic cropping system. Sabrao Journal of Breeding and Genetics.

Bandi, Hermawan and Pajrina, Pajrina and Sumardi, Sumardi and Indra, Agustian Application of a Dielectric Mea-surement Technique for Calculating Water Loss from Two Texture-contrasting Soils Grown with Upland Rice. Badan Penerbitan Fakultas Pertanian UNIB.

Bandi, Hermawan and Pajrina, Pajrina and Sumardi, Sumardi and Indra, Agustian Application of a Dielectric Mea-surement Technique for Calculating Water Loss from Two Texture-contrasting Soils Grown with Upland Rice. Badan Penerbitan Fakultas Pertanian UNIB.

Faiz, Barchia and Sulistyo, Bambang and Kanang, S. Hindarto and Hery, Suhartoyo Assessment of Air Bengkulu (Indonesia) watershed based on agroecosystem landscape quality and sustainable land use plan. Department of Biology, Universitas Sebelas Maret.

Faiz, Barchia and Sulistyo, Bambang and Kanang, S. Hindarto and Hery, Suhartoyo Assessment of Air Bengkulu (Indonesia) watershed based on agroecosystem landscape quality and sustainable land use plan. Department of Biology, Universitas Sebelas Maret.

Faiz, Barchia and Sulistyo, Bambang and Kanang, S. Hindarto and Hery, Suhartoyo Assessment of Air Bengkulu (Indonesia) watershed based on agroecosystem landscape quality and sustainable land use plan. Department of Biology, Universitas Sebelas Maret.

Chozin, M. and Sumardi, Sumardi Assessment of Variability in Performances of F3 Rice Populations on Inland Swampland in Indonesia”. Asian Journal of Agriculture and Biology.

Mochammad, Ridwan Attractive Ecotourism, Professional Environmental, Management, Poverty, and Social Capital Quality. eai.

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati BALANCING KELESTARIAN DAN PRODUKTIVITAS LAHAN DI KAWASAN PESISIR DAN HUTAN TROPIS BENGKULU MELALUI PEMETAAN POTENSI KETERSEDIAAN AIR TANAH. universitas bengkulu.

Faiz, barchia Carbon Release from Agricultural Cultivated Peats at Sungai Hitam Wetland, Bengkulu Province, Indonesia. International Conference on Inventions and Innovations for Sustainable Agriculture.

Faiz, Barchia Carbon Release from Agricultural Cultivated Peats at Sungai Hitam Wetland, Bengkulu Province, Indonesia. International Conference on Inventions and Innovations for Sustainable Agriculture 2016.

Sudjatmiko, Sigit and Muktamar, Zainal and Chozin, Mohammad and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Changes in chemical properties of soil in an organic agriculture system. IOP Conference Series: Earth and Environmental Science.

Chozin, M. and Sudjatmiko, Sigit Combining ability analysis of ear characteristics of sweet corn hybrids suitable for organic crop production. Journal of Horticultural Research.

Fahrurrozi, Fahrurrozi and Muktamar, Zainal and Setyowati, Nanik and Sudjatmiko, Sigit and Chozin, Mohammad Comparative effects of soil and foliar applications of tithonia-enriched liquid organic fertilizer on yields of sweet corn in closed agriculture production system. Agrivita.

Khairul, Amri and loparedo, nugraha and Faiz, Barchia Critical Level of Water Recharges in the Catchment Areas of Manna Watershed Bengkulu Province Indonesia. ICONBUILD.

Khairul, Amri and loparedo, nugraha and Faiz, Barchia Critical Level of Water Recharges in the Catchment Areas of Manna Watershed Bengkulu Province Indonesia. International Conference on Construction and Building Engineering.

Khairul, Amri and Halim, A. and Ngudiantoro, Ngudiantoro and Faiz, Barchia Criticality Analysis of Recharge Area and Land in the Catchment Area of Musi Hydropower Bengkulu Indonesia. ICESD.

Khairul, Amri and A, Halim and Ngudiantoro, Ngudiantoro and Faiz, Barchia Criticality Analysis of Recharge Area and Land in the Catchment Area of Musi Hydropower Bengkulu Indonesia. International Conference on Environmental Science and Development.

Andreas Junico, Marulitua Situmorang and Bandi, Hermawan and Hesti, Pujiwati Dampak Sistem Olah Tanah dan Mulsa Tandan Kosong Kelapa Sawit Terhadap Pertumbuhan, Hasil Jagung Manis (Zea Mays Saccharata) dan Tata Air Tanah. Badan Penerbitan Fakultas Pertanian Unib.

Andreas Junico, Marulitua Situmorang and Bandi, Hermawan and Hesti, Pujiwati Dampak Sistem Olah Tanah dan Mulsa Tandan Kosong Kelapa Sawit Terhadap Pertumbuhan, Hasil Jagung Manis (Zea Mays Saccharata) dan Tata Air Tanah. Badan Penerbitan Fakultas Pertanian UNIB.

Chozin, M. and Sigit, Sudjatmiko and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Daya gabung karakteristik tongkol dari galur-galur inbrida jagung manis pada system budidaya organik. Jurnal Hortikulura Indonesia.

Ridwan, Mochamad Determinants of Depth and Severity of Poverty in Fishermen and Farmers Communities. Association of Muslim Community in ASEAN (AMCA).

Bandi, Hermawan and Indra, Agustian and Hery, Suhartoyo and Sukisno, Sukisno Dielectric-Based versus Gravimetrically Measured Water Content in Relations to Texture and Organic Carbon of Highland Soils. Sustainable Agriculture, Food and Energy (SAFE).

Bandi, Hermawan and Indra, Agustian and Hery, Suhartoyo and Sukisno, Sukisno Dielectric-Based versus Gravimetrically Measured Water Content in Relations to Texture and Organic Carbon of Highland Soils. Sustainable Agriculture, Food and Energy (SAFE).

Bandi, Hermawan and Hery, Suhartoyo and Sulistyo, Bambang and Bambang, Gonggo M and welly, herman Diversity of soil organic carbon and water characteristics under different vegetation types in northern Bengkulu, Indonesia. Biology department, Sebelas Maret University Surakarta.

Bandi, Hermawan and Hery, Suhartoyo and Sulistyo, Bambang and Bambang, Gonggo M and welly, herman Diversity of soil organic carbon and water characteristics under different vegetation types in northern Bengkulu, Indonesia. Biology department, Sebelas Maret University Surakarta.

Bandi, Hermawan and Hery, Suhartoyo and Sulistyo, Bambang and Bambang, Gonggo M and welly, herman Diversity of soil organic carbon and water characteristics under different vegetation types in northern Bengkulu, Indonesia. Biology department, Sebelas Maret University Surakarta.

Romeida, Atra and Supanjani, Supanjani and Sinaga, S Dokumen Bukti Review Artikel Low-Cost Media for in vitro Multiplication and Development of Protocorm Like Bodies (PLBs) of Eulophia graminea Orchid. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Ganefianti, Dwi Wahyuni and Barchia, M. Faiz and Supanjani, Supanjani and Herawati, Reny Dokumen Bukti Review Artikel Plant Growth Regulator Formulation For Propagating Red Chili UNIB CH23 Hybrid Through Stem Cutting. Universitas Bengkulu. (Unpublished)

Lela, Rospida and Kamaludin, Kamaludin and Mochammad, Ridwan Economic Analysis of Child Labor Based Households in Bengkulu City. EconJournals.

Sulistyo, Bambang and Faiz, Barchia and Kanang, S. Hindarto and noviyanti, lystianingrum The Effect of Land Unit Elimination on The Conservation Activity Plant at Air Bengkulu Watershed, Bengkulu Province. Faculty of Geography Universitas Gadjah Mada and The Indonesian Geographers Association.

Sulistyo, Bambang and Faiz, Barchia and Kanang, S. Hindarto and noviyanti, listyaningrum The Effect of Land Unit Elimination on The Conservation Activity Plant at Air Bengkulu Watershed, Bengkulu Province. Faculty of Geography Universitas Gadjah Mada and The Indonesian Geographers Association.

Chozin, M. and Sumardi, Sumardi and Sudjatmiko, Sigit Empowering smallholder farmers to gain more profitable rice production. Asian Journal For Poverty.

sianturi, s and Muktamar, Zainal and Chozin, Mohammad Enhancing Soil Chemical Properties and Sweet Corn Growth by Solid Organic Amendments in Ultisol. Jurnal TERRA.

Supriyono, suptiyono and fevi, wira citra and Sulistyo, Bambang and Faiz, Barchia Estimasi Perubahan Tutupan Lahan Untuk Deteksi Erosi Tanah di Catchment Area DAS Sungai Bengkulu Dengan Menggunakan Citra Landsat. Seminar Nasional Pendidikan Geografi.

supriyono, supriyono and fevi, wira citra and Sulistyo, Bambang and Faiz, Barchia Estimasi Perubahan Tutupan Lahan Untuk Deteksi Erosi Tanah di Catchment Area DAS Sungai Bengkulu Dengan Menggunakan Citra Landsat. Estimasi Perubahan Tutupan Lahan Untuk Deteksi Erosi Tanah di Catchment Area DAS Sungai Bengkulu Dengan Menggunakan Citra Landsat.

Ridwan, Mochamad Evaluasi kinerja pembangunan daerah Provinsi Bengkulu. Kementerian PPN/Bappenas.

Chozin, M. and Sudjatmiko, Sigit and Muktamar, Zainal and Setyowati, Nanik and Fahrurrozi, Fahrurrozi Evaluasi variabilitas komponen hasil dan hasil jagung manis generasi S5 untuk pengembangan varietas yang beradaptasi pada sistem budidaya organik. Prosiding Seminar Nasional Perhimpunan Pemuliaan Indonesia (PERIPI) Komda Riau.

Romeida, Atra and Ganefianti, Dwi Wahyuni and Rustikawati, Rustikawati and Marlin, Marlin FOLIAR FERTILIZER APLICATION FOR INDUCING RAPID AND UNIFORM FLOWERING ON Spahoglottis plicata Blume. var. ALBA ORCHID. The 3rd International Symposium for Sustainable Humanosphere (ISSH). (Unpublished)

Mochammad, Ridwan Fishermen’s poverty reduction based on integrated marketing system. Association of Muslim Community in ASEAN.

Faiz, Barchia Gambut Agroekosistem dan Transformasi Karbon. GADJAH MADA UNIVERSITY PRESS.

Chozin, Mohammad and Sumardi, Sumardi and Sudjatmiko, Sigit and Faiz, Barchia Genetic variability and traits association analyses on F2 generations for determination of selection criteria in Indonesian inland swamp rice breeding. Australian Journal of Crop Science.

Chozin, Mohammad and Sumardi, Sumardi and Sigit, Sudjatmiko and Faiz, Barchia Genetic variability and traits association analyses on F2 generations for determination of selection criteria in Indonesian inland swamp rice breeding. Southern Cross Publishing.

Chozin, Mohammad and Sumardi, Sumardi and Sigit, Sudjatmiko and Faiz, Barchia Genetic variability and traits association analyses on F2 generations for determination of selection criteria in Indonesian inland swamp rice breeding. Southern Cross Publishing.

sridanti, irma lisa and Herison, Catur and Chozin, Mohammad Growth Analysis of Seven Genotypes Chili Pepper Plant (Capsicum Annuum L.) in Plain Medium. Proceeding: International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone, Faculty of Agriculture, University of Bengkulu.

Chozin, Mohammad and Marwanto, Marwanto and Sudjatmiko, Sigit Growth, Yield Components, and Yield Associations in Rice Grown on Lowland Swamp. Proceeding International Seminar and Expo on Promoting Local Resources For Food And Health.

Romeida, Atra and Ganefianti, Dwi Wahyuni and Barchia, M. Faiz and Supanjani, Supanjani and Herawati, Reny Hasil Peer Review Lampiran IIIB.1.c.1.2. Universitas Bengkulu. (Unpublished)

Herawati, Reny and Lestari, Angelita and Nurmegawati, Nurmegawati and Ganefianti, Dwi Wahyuni and Romeida, Atra Hasil Peer Review Lampiran IIIB.1.c.1.3. Universitas Bengkulu. (Unpublished)

Rustikawati, Rustikawati and Romeida, Atra and Suprijono, Eko and Herison, Catur Hasil Peer Review Lampiran IIIB.1.c.1.4. Universitas Bengkulu. (Unpublished)

Herawati, Reny and Purwoko, Bambang S and Iswari S., Dewi and Romeida, Atra and Ganefianti, Dwi Wahyuni and Marlin, Marlin Hasil Peer Review Lampiran IIIB.1.c.1.5. Universitas Bengkulu. (Unpublished)

Marlin, Marlin and Hartal, Hartal and Romeida, Atra and Herawati, Reny and Marulak, Simarmata Hasil Peer Review Lampiran IIIB.1.c.1.6. Universitas Bengkulu. (Unpublished)

Pujiwati, Hesti and Widodo, Widodo and Romeida, Atra and Suryati, Dotti and husna, muhimmatul and Hidayat, Wahyu and Susilo, Edi Hasil Peer Review Lampiran IIIB.1.c.5.1. Universitas Bengkulu. (Unpublished)

Supanjani, Supanjani and rahayu, hartari and Suprijono, Eko and Romeida, Atra and Yulian, Yulian Hasil Peer Review Lampiran IIIB.1.c.5.2. Universitas Bengkulu. (Unpublished)

Febriani, susti and Ganefianti, Dwi Wahyuni and Romeida, Atra and Herawati, Reny Hasil Peer Review Lampiran IIIB.1.c.5.3. Universitas Bengkulu. (Unpublished)

Iqbal, Muhammad and Barchia, M. Faiz and Romeida, Atra Hasil Peer Review Lampiran IIIB.1.c.5.4. Universitas Bengkulu. (Unpublished)

Herlina, Yeni and Chozin, Mohammad and Romeida, Atra Hasil Peer Review Lampiran IIIB.1.c.5.5. Universitas Bengkulu. (Unpublished)

Yartiwi, Yartiwi and Romeida, Atra and Utama, Satria Putra Hasil Peer Review Lampiran IIIB.1.c.5.6. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Pujiwati, Hesti and Supanjani, Supanjani and Fahrurrozi, Fahrurrozi and Marlin, Marlin and Herawati, Reny Hasil Peer Review Lampiran IIIB.2.a.3.1. Universitas Bengkulu. (Unpublished)

Herawati, Reny and Ganefianti, Dwi Wahyuni and Romeida, Atra and Marlin, Marlin and Rustikawati, Rustikawati and Habibi, Habibi Hasil Peer Review Lampiran IIIB.2.a.3.2. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Dukma, dewi and Rustikawati, Rustikawati Hasil Peer Review Lampiran IIIB.7.b.1. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Dukma, dewi and Rustikawati, Rustikawati Hasil Peer Review Lampiran IIIB.7.b.2. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Dukma, Dewi and Rustikawati, Rustikawati Hasil Peer Review Lampiran IIIB.7.b.3. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Dukma, Dewi and Rustikawati, Rustikawati Hasil Peer Review Lampiran IIIB.7.b.4. Universitas Bengkulu. (Unpublished)

Ganefianti, Dwi Wahyuni and Hidayat, sri hedrastuti and Syukur, muhamad and Fahrurrozi, Fahrurrozi and Romeida, Atra Hasil Peer Review Lampiran IIIB.7.b.5. Universitas Bengkulu. (Unpublished)

Rustikawati, Rustikawati and Herison, Catur and Romeida, Atra and Suprijono, Eko and Sutjahjo, Surjono H. Hasil Peer Review Lampiran IIIB.7.b.6. Universitas Bengkulu. (Unpublished)

Ganefianti, Dwi Wahyuni and Alnopri, Alnopri and Romeida, Atra and Taufik, Muhammad and Saputra, Helfi Eka and Utami, Arfinda Lupi Hasil Peer Review Lampiran IIIB.7.b.7. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Supanjani, Supanjani and Sinaga, S Hasil Peer review Lampiran IIIB.1.c.1.1. Universitas Bengkulu. (Unpublished)

Herawati, Reny and Ganefianti, Dwi Wahyuni and Romeida, Atra and Marlin, Marlin and Rustikawati, Rustikawati and Habibi, Habibi Hasil Turnitin Addition of Coconut Water and Banana Extract on MS Media to Stimulate PLB (Protocorm Like Bodies) Regeneration of Dendrobiumgatton sunray. Universitas Bengkulu. (Unpublished)

Herawati, Reny and Purwoko, Bambang S and Dewi, Iswari and Romeida, Atra and Ganefianti, Dwi Wahyuni and Marlin, Marlin Hasil Turnitin Analysis of polyethylene glycol (PEG) and proline to evaluate drought stress of double haploid new type upland rice lines. Universitas Bengkulu. (Unpublished)

Sukma, Dewi and Aziz, Sandra Arifin and Sudarsono, Sudarsono and Romeida, Atra and Handini, Aline Sisi and Raynalta, Erick Hasil Turnitin BREEDING, CLONAL PROPAGATION AND APPLICATION OF MOLECULAR MARKER ANALYSIS OF Phalaenopsis. Proceeding International Symposium on Sustalnablllty Science. (Unpublished)

Herawati, Reny and Lestari, Angel Puji and Nurmegawati, Nurmegawati and Ganefianti, Dwi Wahyuni and Romeida, Atra Hasil Turnitin Comparative study on the stability and adaptability of different models to develop a high-yield inbred line from landrace rice varieties. Universitas Bengkulu. (Unpublished)

Rustikawati, Rustikawati and Romeida, Atra and Suprijono, Eko and Herison, Catur Hasil Turnitin Growth Performance and AMMI Yield Stability Analysis of Five New Maize Hybrid Populations. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Wiryono, Wiryono Hasil Turnitin In Vitro Propagule Production of Superior Mangosteen (Garcinia mangostana L.). International Seminar on Promoting Local Resources for Food and Health. (Unpublished)

Romeida, Atra and Supanjani, Supanjani and Sinaga, S Hasil Turnitin Low-Cost Media for in vitro Multiplication and Development of Protocorm Like Bodies (PLBs) of Eulophia graminea Orchid. Universitas Bengkulu. (Unpublished)

Aziz, Sandra Arifin and Sukma, Dewi and Romeida, Atra Hasil Turnitin Morphological Characterization of Phalaenopsis spp. and Hybrids from Indonesia. Proc. IInd Intl. Orchid Symposium. (Unpublished)

Marlin, Marlin and Hartal, Hartal and Romeida, Atra and Herawati, Reny and Simarmata, Marulak Hasil Turnitin Morphological and flowering characteristics of shallot (allium cepa var. Aggregatum) in response to gibberellic acid and vernalization. Universitas Bengkulu. (Unpublished)

Romeida, Atra and Ganefianti, Dwi Wahyuni and Barchia, M. Faiz and Supanjani, Supanjani and Herawati, Reny Hasil Turnitin Plant growth regulator formulation for propagating Red Chili UNIB CH23 hybrid through stem cutting. Universitas Bengkulu. (Unpublished)

Sukma, Dewi and Aziz, Sandra Arifin and Sudarsono, Sudarsono and Romeida, Atra and Fatimah, Fatimah Hasil Turnitin Pollination Success among Standard Hybrids and Indonesian Species of Phalaenopsis. Proc. IInd Intl. Orchid Symposium. (Unpublished)

Romeida, Atra and Pujiwati, Hesti and Supanjani, Supanjani and Fahrurrozi, Fahrurrozi and Marlin, Marlin and Herawati, Reny Hasil Turnitin The Induction of Callus in Four Diverse Black Soybeans (Glycine soja Sieb. & Zucc) with Various Combinations of Cytokinins and 2,4-Dichlorophenoxyacetinic Acid. Universitas Bengkulu. (Unpublished)

Rustikawati, Rustikawati and Herison, Catur and Turmudi, Edhi and Romeida, Atra and Supanjani, Supanjani and Komalasari, Ayu Hasil Turnitin Yield Trial Of 5 Single Cross Hybrids From Gamma Ray Radiation Inbred Lines Of Maize. International Seminar on Promoting Local Resources for Food and Health. (Unpublished)

dewi, anggraini and Faiz, Barchia and Yen, Erfieni Hubungan Berat Tandam Buah Segar Kelapa Sawit Dengan Ca, Mg, Dan KTK Tanah Pada Ultisol Bengkulu. Badan Penerbitan Fakultas Pertanian UNIB.

Bandi, Hermawan and mutiara, aisyah and tri, dame w o Hubungan Kemiringan Lahan dengan Kadar Air Tanah dan Tampilan Tanaman Kelapa Sawit Menghasilkan. Prosiding Seminar Nasional Dies FP-UNS.

Bandi, Hermawan and mutiara, aisyah and tri, dame w o Hubungan Kemiringan Lahan dengan Kadar Air Tanah dan Tampilan Tanaman Kelapa Sawit Menghasilkan. Prosiding Seminar Nasional Dies FP-UNS.

Lorenza, Eviya and Chozin, M. and Nanik, Setyowati Hubungan antar sifat jagung manis yang dibudidayakan secara organik. Akta Agrosia.

dwi, tyas and Bandi, Hermawan Hubungan antara Beberapa Karakteristik Fisik Lahan dan Produksi Kelapa Sawit. Badan Penerbitan Fakultas Pertanian Unib.

dwi, tyas and Bandi, Hermawan Hubungan antara Beberapa Karakteristik Fisik Lahan dan Produksi Kelapa Sawit. Badan Penerbitan Fakultas Pertanian UNIB.

Chozin, M. and Sudjatmiko, Sigit and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Muktamar, Zainal Hybrid Performances and Heterosis in Sweet Corn As Grown Under Organic Crop Management in Tropical Highland Climate. International Journal of Agricultural Technology.

Mochammad, Ridwan and Izharudin, Izharudin and waldi, novriyarsyah Kedalaman dan keparahan kemiskinan masyarakat nelayan: studi dengan pendekatan ekonomi dan sosial. Prodi Ilmu Kelautan UNIB.

Faiz, Barchia and s nur, muin and Mukhtasar,, Mukhtasar, and n c, deta Koreksi Kesesuaian Lahan Dengan Referensi Kesesuaian Suh Pertanaman Kentang Merah Pada Dataran Sedang Bengkulu. Jurusan Agroekoteknologi, Fakultas Pertanian, Universitas Sultan Ageng Tirtayasa.

Faiz, Barchia and s nur, muin and Mukhtasar,, Mukhtasar, and n c, deta Koreksi Kesesuaian Lahan Dengan Referensi Kesesuaian Suh Pertanaman Kentang Merah Pada Dataran Sedang Bengkulu. Jurusan Agroekoteknologi, Fakultas Pertanian, Universitas Sultan Ageng Tirtayasa.

Faiz, Barchia and Khairul, Amri and renra, apriantoni Land Degradation and Option of Practical Conservation Concepts in Manna Watershed Bengkulu Indonesia. Department of Soil Science, Faculty of Agriculture, University of Bengkulu.

Faiz, Barchia and Khairul, Amri and renra, apriantoni Land Degradation and Option of Practical Conservation Concepts in Manna Watershed Bengkulu Indonesia. Department of Soil Science, Faculty of Agriculture, University of Bengkulu.

Faiz, Barchia and Sukisno, Sukisno and Heru, Widiyono and Satria, Putra Utama Land Suitable Areas Refer to Red Potato Planted on Medium Altitude in Rejang Lebong Bengkulu Province Indonesia. INSIGHT.

Faiz, Barchia and Sukisno, Sukisno and Heru, Widiyono and Satria, Putra Utama Land Suitable Areas Refer to Red Potato Planted on Medium Altitude in Rejang Lebong Bengkulu Province Indonesia. INSIGHT.

Faiz, Barchia and Sukisno, Sukisno and Heru, Widiyono and Satria, Putra Utama Land Suitable Areas Refer to Red Potato Planted on Medium Altitude in Rejang Lebong Bengkulu Province Indonesia. INSIGHT.

Bandi, Hermawan and Indra, Agustian and Hasanudin, Hasanudin MODELING PREDIKSI KARAKTERISTIK KELEMBABAN TANAH SKALA WILAYAH KABUPATEN DI PROVINSI BENGKULU MELALUI PENERAPAN TEKNOLOGI PENGUKUR SIFAT DIELEKTRIK TANAH. universitas bengkulu.

supriyono, supriyono and fevi, wira citra and Sulistyo, Bambang and Faiz, Barchia Mapping Erosivity Rain And Spatial Distribution Of Rainfall In Catchment Area Bengkulu River Watershed. IISTE.

supriyono, supriyono and fevi, wira citra and Sulistyo, Bambang and Faiz, Barchia Mapping Erosivity Rain And Spatial Distribution Of Rainfall In Catchment Area Bengkulu River Watershed. IISTE.

Bandi, Hermawan Membandingkan Kelembaban Tanah pada Perkebunan Kelapa Sawit dan Karet Menghasilkan. Prosiding Seminar Nasional FKPTPI.

Bandi, Hermawan Membandingkan Kelembaban Tanah pada Perkebunan Kelapa Sawit dan Karet Menghasilkan. Prosiding Seminar Nasional FKPTPI.

Khairul, Amri and Ngudiantoro, Ngudiantoro and Faiz, Barchia Model Pengelolaan Daerah Aliran Sungai (DAS) Musi Bagian Hulu Dalam Upaya Pelestarian Fungsi Ekohidrologi. universitas sriwajaya.

Mochammad, Ridwan and romi, gunawan Model Pengelolaan Sumberdaya Alam Kelautan dengan Pendekatan Sosial Ekonomi. Badan Penerbitan Fakultas Pertanaian UNIB.

Bandi, Hermawan Monitoring Real-Time dan Modeling Kelembaban Tanah. Cipta Media Nusantara.

Chozin, Mohammad and Pujiwati, Hesti and Rustikawati, Rustikawati and Sumardi, Sumardi Optimization of PCR Protocol and Primers Screening for Development of Rapid Marker Associated with Submergence Tolerance in Rice Genotypes. Proceeding: International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone, Faculty of Agriculture, University of Bengkulu.

Faiz, Barchia Options for Land Conservation Practices Based on Land Uses in Kungkai Watershed, Bengkulu, Sumatera, Indonesia. IACSIT Press.

Faiz, Barchia Options for Land Conservation Practices Based on Land Uses in Kungkai Watershed, Bengkulu, Sumatera, Indonesia. IACSIT Press.

Faiz, Barchia Options for Land Conservation Practices Based on Land Uses in Kungkai Watershed, Bengkulu, Sumatera, Indonesia. IACSIT Press.

Faiz, Barchia and Khairul, Amri and friski, namura Options for land conservation practices based on land use and land degradation in upland Luas Watershed Bengkulu Indonesia. SICEST.

Faiz, Barchia and Khairul, Amri and friski, namura Options for land conservation practices based on land use and land degradation in upland Luas Watershed Bengkulu Indonesia. SICEST.

Daryono, Daryono PENGANTAR OTOMASI PERPUSTAKAAN. UPT Perpustakaan, Bengkulu.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review " Combining ability analysis of ear characteristics of sweet corn hybrids suitable for organic crop production. Journal of Horticultural Research.

Chozin, Mohammad and sarina, silalahi and Masdar, Masdar and Sumardi, Sumardi Peer Review : Agronomic Performances of Rice Lines on Non-Tidal Swampland. Akta Agrosia.

Chozin, Mohammad and Sudjatmiko, Sigit and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Zainal, Muktamar Peer Review : Analysis of traits association in sweet corn inbred lines as grown under organic cropping system. Sabrao Journal of Breeding and Genetics.

Chozin, Mohammad and Sumardi, Sumardi Peer Review : Assessment of Variability in Performances of F3 Rice Populations on Inland Swampland in Indonesia. Asian Journal of Agriculture and Biology.

Sigit, Sudjatmiko and Zainal, Muktamar and Chozin, Mohammad and Fahrurrozi, Fahrurrozi and Nanik, Setyowati Peer Review : Changes in chemical properties of soil in an organic agriculture system. IOP Conference Series: Earth and Environmental Science.

Fahrurrozi, Fahrurrozi and Zainal, Muktamar and Nanik, Setyowati and Sigit, Sudjatmiko and Chozin, Mohammad Peer Review : Comparative effects of soil and foliar applications of tithonia-enriched liquid organic fertilizer on yields of sweet corn in closed agriculture production system. Agrivita.

Chozin, Mohammad and Sigit, Sudjatmiko and Nanik, Setyowati and Fahrurrozi, Fahrurrozi and Zainal, Muktamar Peer Review : Daya gabung karakteristik tongkol dari galur-galur inbrida jagung manis pada system budidaya organik. Jurnal Hortikulura Indonesia.

Chozin, Mohammad and Sumardi, Sumardi and Sigit, Sudjatmiko Peer Review : Empowering smallholder farmers to gain more profitable rice production. Asian Journal For Poverty.

Chozin, Mohammad and Sigit, Sudjatmiko and Zainal, Muktamar and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Peer Review : Evaluasi variabilitas komponen hasil dan hasil jagung manis generasi S5 untuk pengembangan varietas yang beradaptasi pada sistem budidaya organik. Universitas Riau Press.

Chozin, Mohammad and Sumardi, Sumardi and Sigit, Sudjatmiko and Faiz, Barchia Peer Review : Genetic variability and traits association analyses on F2 generations for determination of selection criteria in Indonesian inland swamp rice breeding. Australian Journal of Crop Science.

irma, lisa and Catur, Herison and Chozin, Mohammad Peer Review : Growth Analysis of Seven Genotypes Chili Pepper Plant (Capsicum Annuum L.) in Plain Medium. International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone, Faculty of Agriculture, University of Bengkulu.

Chozin, Mohammad and Marwanto, Marwanto and Sigit, Sudjatmiko Peer Review : Growth, Yield Components, and Yield Associations in Rice Grown on Lowland Swamp. Proceeding International Seminar and Expo on Promoting Local Resources For Food And Health.

eviya, lorenza and Chozin, Mohammad and Nanik, Setyowati Peer Review : Hubungan antar sifat jagung manis yang dibudidayakan secara organik. Akta Agrosia.

Chozin, Mohammad and Sigit, Sudjatmiko and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Peer Review : Hybrid Performances and Heterosis in Sweet Corn As Grown Under Organic Crop Management in Tropical Highland Climate. International of Journal Agriculture Technology.

Chozin, M. and Hesti, Pujiwati and Rustikawati, Rustikawati and Sumardi, Sumardi Peer Review : Optimization of PCR Protocol and Primers Screening for Development of Rapid Marker Associated with Submergence Tolerance in Rice Genotypes. International Seminar and Expo on Sustainable Utilization of Coastal Resources in Tropical Zone.

Sumardi, Sumardi and Chozin, Mohammad and Hermansyah, Hermansyah Peer Review : Penampilan Ratun dari Galur-Galur Padi keturunan Varietas Lokal Bengkulu pada Lahan Rawa Lebak. Jurnal Lahan Suboptimal.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review : Perakitan Varietas jagung manis hasil Pemuliaan Tanaman: "Caps 22”. Pusat Perlindungan Varietas Tanaman dan Perizinan Pertanian, Kementerian Pertanian.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review : Perakitan Varietas jagung manis hasil Pemuliaan Tanaman: "Caps 5”. Pusat Perlindungan Varietas Tanaman dan Perizinan Pertanian, Kementerian Pertanian.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review : Perakitan Varietas jagung manis hasil Pemuliaan Tanaman: "Caps17A”. Pusat Perlindungan Varietas Tanaman dan Perizinan Pertanian, Kementerian Pertanian.

Chozin, Mohammad and Sigit, Sudjatmiko and Zainal, Muktamar and Fahrurrozi, Fahrurrozi and Nanik, Setyowati Peer Review : Performances and genetic parameters estimation of yield and yield related traits of sweet corn inbred lines selected for better adapted to organic cropping system. Performances and genetic parameters estimation of yield and yield related traits of sweet corn inbred lines selected for better adapted to organic cropping system.

Sigit, Sudjatmiko and Zainal, Muktamar and Chozin, Mohammad and Fahrurrozi, Fahrurrozi and Nanik, Setyowati Peer Review : Poverty and education: Impacts on the peticide usage and health of vegetable farmer. International Seminar of RENPER,.

Chozin, Mohammad and Sigit, Sudjatmiko and Nanik, Setyowati and Zainal, Muktamar and Fahrurrozi, Fahrurrozi Peer Review : Progress in sweet corn hybrid breeding program for organic agriculture in the tropics. International Conference on Integration of Science and Technology for Sustainable Development.

Zainal, Muktamar and Sigit, Sudjatmiko and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Chozin, Mohammad Peer Review : Soil chemical improvement under application of liquid organic fertilizer in closed agriculture system. International Journal of Agricultural Technology.

Zainal, Muktamar and Sigit, Sudjatmiko and Chozin, Mohammad and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Peer Review : Sweet corn performance and its major nutrient uptake following application of vermicompost supplemented with liquid organic fertilizer. International Journal on Advance Science Engineering Information Technology.

Chozin, Mohammad and Hartal, Hartal and guspitasari, y and Sigit, Sudjatmiko Peer Review : The potential use of plant extracts for controlling northern leaf blight on organic sweet corn production. IOP Conference Series: Earth and Environmental Science.

Chozin, Mohammad and Sigit, Sudjatmiko and Zainal, Muktamar and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Peer Review : Variability in growth and yield among sweet corn genotypes grown under organic crop management. IOP Conference Series: Earth and Environmental Science.

sianturi, sm and Zainal, Muktamar and Chozin, Mohammad Peer Review :Enhancing Soil Chemical Properties and Sweet Corn Growth by Solid Organic Amendments in Ultisol. TERRA.

Chozin, Mohammad and Sumardi, Sumardi Peer Review :Penampilan Agronomis Segregan Padi Generasi F3 pada Lahan Rawa Lebak. Seminar Nasional Lahan Subtoptimal.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review :Performances of sweet corn hybrids under organic crop management across three agro-climatic zones of the tropics. International Journal of Agricultural Technology.

Chozin, Mohammad and Resti, Puspita and Enggar, Apriyanto and Sigit, Sudjatmiko Peer Review: Determination of Factors Affecting The Adoption of Farmer Field School on Integrated Crop Management for Lowland Rice: A Case Study in District of South Lebong, Bengkulu Province, Indonesia. Renper.

tita, marta and Chozin, Mohammad and Usman, Kris Joko Suharjo and Nanik, Setyowati Peer Review: Pengujian 13 jagung manis hibrida di ultisol. Jurnal Agrin.

Chozin, Mohammad and Sigit, Sudjatmiko Peer Review: Perakitan Varietas jagung manis hasil Pemuliaan Tanaman: "Caps 23”. Pusat Perlindungan Varietas Tanaman dan Perizinan Pertanian, Kementerian Pertanian.

Ridwan, Mochamad Pembangunan ekonomi berkelanjutan berbasis modal manusia, sumberdaya alam, dan sumberdaya modal di Bengkulu. Program Pascasarjana Ilmu Ekonomi, Magister Ekonomi Terapan dan Doktor Ilmu Ekonomi UNIB.

Mochammad, Ridwan Pemberdayaan UKM era New Normal: Ritel Tradisional vs Ritel Modern di Era New Normal. Direktorat Program Pascasarjana Universitas Muhammadiyah Malang.

Sumardi, Sumardi and Chozin, M. and Hermansyah, Hermansyah Penampilan Ratun dari Galur-Galur Padi keturunan Varietas Lokal Bengkulu pada Lahan Rawa Lebak. Jurnal Lahan Suboptimal.

Mochammad, Ridwan Penguatan ekonomi masyarakat berbasis kelompok. Department of Economics and Development Studies, Faculty of Economics and Business.

Sela, Tita Marta and Chozin, M. and Usman, Kris Joko Suharjo and Nanik, Setyowati Pengujian 13 jagung manis hibrida di ultisol. Agrin.

Sela, Tita Marta and Chozin, Mohammad and Usman, Kris Joko Suharjo and Setyowati, Nanik Pengujian 13 jagung manis hibrida di ultisol. Similarity Check.

Bandi, Hermawan Peningkatan Kualitas Lahan Bekas Tambang melalui Revegetasi dan Kesesuaiannya Sebagai Lahan Pertanian Tanaman Pangan. Prosiding Seminar Nasional Budidaya Pertanian.

Bandi, Hermawan Peningkatan Kualitas Lahan Bekas Tambang melalui Revegetasi dan Kesesuaiannya Sebagai Lahan Pertanian Tanaman Pangan. Prosiding Seminar Nasional Budidaya Pertanian, Bengkulu.

Mucharromah, Mucharromah and Teguh, Adi Prasetyo and Merakati, Handajaningsih and Hidayat, Hidayat Perbaikan Karakteristik Fisik, Kimia, dan Biologi Tanah Pasca Pemberian Biofertilizer Biom3g. fakultas pertanian universitas bengkulu.

Faiz, Barchia and Natalia, Silalahi and Asrul, Sani Performances of Coleus tuberosum on An Acid Mineral Soil in Bengkulu. International Seminar and Expo on Promoting Local Resources For Food And Health.

Faiz, Barchia and Natalia, Silalahi and Asrul, Sani Performances of Coleus tuberosum on An Acid Mineral Soil in Bengkulu. International Seminar and Expo on Promoting Local Resources For Food And Health.

Chozin, M. and Sudjatmiko, Sigit Performances of sweet corn hybrids under organic crop management across three agro-climatic zones of the tropics. International Journal of Agricultural Technology.

Rosanti, sari simamora and Dwi Wahyuni, Ganefianti and Faiz, Barchia Pertumbuhan Vegetatif Seedling Anggrek Dendrobium Woon Leng Dengan Menggunakan Berbagai Media Tanam. Badan Penerbitan Fakultas Pertanian UNIB.

muhammad, iqbal and Faiz, Barchia and Atra, Romeida Pertumbuhan dan Hasil Tanaman Melon (Cucumis Melo L.) Pada Komposisi Media Tanam dan Frekuensi Pemupukan yang Berbeda. faiz_barchia@yahoo.com.

muhammad, iqbal and Faiz, Barchia and Atra, Romeida Pertumbuhan dan Hasil Tanaman Melon (Cucumis Melo L.) Pada Komposisi Media Tanam dan Frekuensi Pemupukan yang Berbeda. Badan Penerbitan Fakultas Pertanaian UNIB.

Atra, Romeida and Dwi Wahyuni, Ganefianti and Faiz, Barchia and Supanjani, Supanjani and Reny, Herawati Plant growth regulator formulation for propagating Red Chili UNIB CH23 hybrid through stem cutting. Association of Agricultural Technology in Southeast Asia (AATSEA).

Atra, Romeida and Dwi Wahyuni, Ganefianti and Faiz, Barchia and Supanjani, Supanjani and Reny, Herawati Plant growth regulator formulation for propagating Red Chili UNIB CH23 hybrid through stem cutting. Association of Agricultural Technology in Southeast Asia (AATSEA).

Ridwan, Mochamad Poverty Reduction Through Strengthening the Role of Cooperative Institution: Case Study of Rural Rice Farmingcommunities. Badan Penerbitan Fakultas Pertanaian UNIB.

Marulak, Simarmata and Faiz, Barchia and Santo Nicolas, Simatupang Prospect for Growing Sorghum (Sorghum bicolor L. Moench) at Marginal Dry Land in Coastal Area Retrieved with Organic Soil Amendments. Asian Network for Scientific Information.

Marulak, Simarmata and Faiz, Barchia and Santo Nicolas, Simatupang Prospect for Growing Sorghum (Sorghum bicolor L. Moench) at Marginal Dry Land in Coastal Area Retrieved with Organic Soil Amendments. Asian Network for Scientific Information.

Bandi, Hermawan and edwin, suparjo and Kanang, S. Hindarto and romeo, silalahi and Faiz, Barchia A Quick Dielectric Method to Determine Insitu Soil Water Content for Precision Water Use under Sustainable Agricultural Practices. INSIGHT.

Bandi, Hermawan and edwin, suparjo and Kanang, S. Hindarto and romeo, silalahi and Faiz, Barchia A Quick Dielectric Method to Determine Insitu Soil Water Content for Precision Water Use under Sustainable Agricultural Practices. INSIGHT.

Bandi, Hermawan and edwin, suparjo and Kanang, S. Hindarto and romeo, silalahi and Faiz, Barchia A Quick Dielectric Method to Determine Insitu Soil Water Content for Precision Water Use under Sustainable Agricultural Practices. INSIGHT.

Bandi, Hermawan and edwin, suparjo and Kanang, S. Hindarto and Hery, Suhartoyo and Faiz, Barchia A Quick Dielectric Method to Determine Insitu Soil Water Content for Precision Water Use under Sustainable Agricultural Practices. INSIGHT.

Bandi, Hermawan and edwin, suparjo and Kanang, S. Hindarto and Hery, Suhartoyo and Faiz, Barchia A Quick Dielectric Method to Determine Insitu Soil Water Content for Precision Water Use under Sustainable Agricultural Practices. INSIGHT.

Bandi, Hermawan and Indra, Agustian and Hery, Suhartoyo and Sukisno, Sukisno RANCANG BANGUN HANDHELD SOIL MOISTURE METER UNTUK MENGUKUR KADAR AIR TANAH SECARA IN-SITU. universitas bengkulu.

Khairul, Amri and Halim, A. and Ngudiantoro, Ngudiantoro and Faiz, Barchia Rainfall Analysis for Estimation of Peak Discharge and Soil Erosion on the Catchment Area of Musi Hydro-Power Plant, Bengkulu Indonesia. IACSIT.

Khairul, Amri and A, Halim and Ngudiantoro, Ngudiantoro and Faiz, Barchia Rainfall Analysis for Estimation of Peak Discharge and Soil Erosion on the Catchment Area of Musi Hydro-Power Plant, Bengkulu Indonesia. IACSIT.

Bandi, Hermawan and Reny, Herawati and Alnopri, Alnopri and Bambang, Gonggo M Redistribution of Rainfall Water in The Root Zones of Mature Oil Palm Growing on Different Slope Steepness. Sustainable Agriculture, Food and Energy (SAFE).

Bandi, Hermawan and Reny, Herawati and Alnopri, Alnopri and Bambang, Gonggo M Redistribution of Rainfall Water in The Root Zones of Mature Oil Palm Growing on Different Slope Steepness. Sustainable Agriculture, Food and Energy (SAFE).

azis, febrianto and Hermansyah, Hermansyah and Faiz, Barchia Respon Pertumbuhan Stek Batang Tanaman Buah Naga Merah (Hylocereus Costaricensis) Terhadap Konsentrasi Dan Lama Perendaman Air Kelapa Muda. Badan Penerbitan Fakultas Pertanaian UNIB.

azis, febrianto and Hermansyah, Hermansyah and Faiz, Barchia Respon Pertumbuhan Stek Batang Tanaman Buah Naga Merah (Hylocereus Costaricensis) Terhadap Konsentrasi Dan Lama Perendaman Air Kelapa Muda. Badan Penerbitan Fakultas Pertanaian UNIB.

Faiz, Barchia and Andi, ishak and Satria, Putra Utama and ridha, rizki novanda Rice Yield Related to Fertilizers Applied by Farmers on Two Areas of Marginal Peat Soil in Bengkulu Indonesia. Science Publications.

Faiz, Barchia and Andi, Ishak and Satria, Putra Utama and ridha, rizki novanda Rice Yield Related to Fertilizers Applied by Farmers on Two Areas of Marginal Peat Soil in Bengkulu Indonesia. Science Publications.

Faiz, Barchia and Andi, Ishak and Satria, Putra Utama and ridha, rizki novanda Rice Yield Related to Fertilizers Applied by Farmers on Two Areas of Marginal Peat Soil in Bengkulu Indonesia. Science Publications.

Reny, Herawati and Masdar, Masdar and Dwi Wahyuni, Ganefianti and Bandi, Hermawan and Alnopri, Alnopri Screening and Identification of Upland Rice Lines Derived Recurrent Selection for Drought Tolerance. INSIGHT.

Reny, Herawati and Masdar, Masdar and Dwi Wahyuni, Ganefianti and Bandi, Hermawan and Alnopri, Alnopri Screening and Identification of Upland Rice Lines Derived Recurrent Selection for Drought Tolerance. INSIGHT.

Reny, Herawati and Masdar, Masdar and Dwi Wahyuni, Ganefianti and Bandi, Hermawan and Alnopri, Alnopri Screening and Identification of Upland Rice Lines Derived Recurrent Selection for Drought Tolerance. INSIGHT.

Bandi, Hermawan and Indra, Agustian and Hery, Suhartoyo and Sukisno, Sukisno A Simple Alternative Instrument for Measuring Temporal Soil Water Content in Repacked Soils. 2nd International Symposium on Sustainable Agriculture and Agro-Industry.

Bandi, Hermawan and Indra, Agustian and Hery, Suhartoyo and Sukisno, Sukisno A Simple Alternative Instrument for Measuring Temporal Soil Water Content in Repacked Soils. International Symposium on Sustainable Agriculture and Agro-Industry.

Mochammad, Ridwan and akhsanul, in'am Social capital deviation in capital assistance system: Socio-Economics studies of coastal communities. MDPI Multidisciplinary Digitial Publishing Institute.

Mochammad, Ridwan Social capital deviation in capital assistance system: Socio-Economics studies of coastal communities. MDPI Multidisciplinary Digitial Publishing Institute.

Mochammad, Ridwan and akhsanul, in'am Social capital deviation in capital assistance system: Socio-Economics studies of coastal communities. MDPI Multidisciplinary Digitial Publishing Institute.

Mochammad, Ridwan and akhsanul, in'am Social capital deviation in capital assistance system: Socio-Economics studies of coastal communities. MDPI Multidisciplinary Digitial Publishing Institute.

Mochammad, Ridwan Social capital-based integrated strategy for developing export-oriented people's coffee. atlantis press.

Zainal, Muktamar and Sigit, Sudjatmiko Soil chemical improvement under application of liquid organic fertilizer in closed agriculture system. International Journal of Agricultural Technology.

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati and Bambang, Gonggo M and Hasanudin, Hasanudin and Indra, Agustian Spatial Variability in Soil Water under Adjacent Mature Oil Palm and Rubber Plantations: Application of a New Dielectric Method in Evaluating Soil Water. Asociation of Agriculture Technology in Shoutheast Asia.

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati and Sukisno, Sukisno and Bambang, Gonggo M and Hasanudin, Hasanudin and Indra, Agustian Spatial Variability in Soil Water under Adjacent Mature Oil Palm and Rubber Plantations: Application of a New Dielectric Method in Evaluating Soil Water. Asociation of Agriculture Technology in Shoutheast Asia.

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati and Sukisno, Sukisno and Bambang, Gonggo M and Hasanudin, Hasanudin and Indra, Agustian Spatial variability in soil water under adjacent mature oil palm and rubber plantations: application of a new dielectric method in evaluating soil water. Association of Agricultural Technology in Southeast Asia (AATSEA).

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati and Sukisno, Sukisno and Bambang, Gonggo M and Hasanudin, Hasanudin and Indra, Agustian Spatial variability in soil water under adjacent mature oil palm and rubber plantations: application of a new dielectric method in evaluating soil water. Association of Agricultural Technology in Southeast Asia (AATSEA).

Bandi, Hermawan and Hery, Suhartoyo and Anandyawati, Anandyawati and Sukisno, Sukisno and Bambang, Gonggo M and Hasanudin, Hasanudin and Indra, Agustian Spatial variability in soil water under adjacent mature oil palm and rubber plantations: application of a new dielectric method in evaluating soil water. Association of Agricultural Technology in Southeast Asia (AATSEA).

Bandi, Hermawan and Indra, Agustian and Hasanudin, Hasanudin and Reny, Herawati and Bambang, Gonggo M Spatiotemporal Variability in Soil Water Content Profiles under Young and Mature Oil Palm Plantations in North Bengkulu Regency. INSIGHT.

Bandi, Hermawan and Indra, Agustian and Hasanudin, Hasanudin and Reny, Herawati and Bambang, Gonggo M Spatiotemporal Variability in Soil Water Content Profiles under Young and Mature Oil Palm Plantations in North Bengkulu Regency. INSIGHT.

Bandi, Hermawan and Indra, Agustian and Hasanudin, Hasanudin and Reny, Herawati and Bambang, Gonggo M Spatiotemporal Variability in Soil Water Content Profiles under Young and Mature Oil Palm Plantations in North Bengkulu Regency. INSIGHT.

Alnopri, Alnopri and Bandi, Hermawan Sustainability for Growth and Productivity of Arabica Coffee in Lowland Regions of Bengkulu Province. INSIGHT.

Alnopri, Alnopri and Bandi, Hermawan Sustainability for Growth and Productivity of Arabica Coffee in Lowland Regions of Bengkulu Province. INSIGHT.

Bandi, Hermawan Sustainable Agroforestry Models for Proposed Food Production in Post-Mined Land Sites of South Sumatera. INSIGHT.

Bandi, Hermawan Sustainable Agroforestry Models for Proposed Food Production in Post-Mined Land Sites of South Sumatera. INSIGHT.

Bandi, Hermawan Sustainable Agroforestry Models for Proposed Food Production in Post-Mined Land Sites of South Sumatera. INSIGHT.

Muktamar, Zainal and Sudjatmiko, Sigit and Chozin, M. and Nanik, Setyowati and Fahrurrozi, Fahrurrozi Sweet corn performance and its major nutrient uptake following application of vermicompost supplemented with liquid organic fertilizer. International Journal on Advance Science Engineering Information Technology.

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Sukma, Dewi and Rustikawati, Rustikawati and Ganefianti, Dwi Wahyuni Tanda Daftar Varietas Tanaman yaitu varietas Anggrek UNIB ASMARA. Kementerian Pertanian. (Unpublished)

Romeida, Atra and Sutjahjo, Surjono H. and Purwito, Agus and Sukma, Dewi and Rustikawati, Rustikawati Tanda Daftar Varietas Tanaman yaitu varietas Anggrek UNIB ASMURIA. Kementerian Pertanian. (Unpublished)

Bandi, Hermawan Teknik Penetapan Kebutuhan Air bagi Tanaman Melalui Pengukuran Sifat Dielektrik Tanah. Seminar Nasional Kegiatan Semirata BKS-PTN.

Bandi, Hermawan Teknik Penetapan Kebutuhan Air bagi Tanaman Melalui Pengukuran Sifat Dielektrik Tanah. Seminar Nasional Kegiatan Semirata BKS-PTN.

Bandi, Hermawan and Hasanudin, Hasanudin and Indra, Agustian Temporal and Vertical Changes in Volumetric Water Content at Four Contrasting-Textured Soils. Sustainable Agriculture, Food and Energy (SAFE).

Bandi, Hermawan and Hasanudin, Hasanudin and Indra, Agustian Temporal and Vertical Changes in Volumetric Water Content at Four Contrasting-Textured Soils. Sustainable Agriculture, Food and Energy (SAFE).

Chozin, Mohammad and Sudjatmiko, Sigit and Fahrurrozi, Fahrurrozi and Nanik, Setyowati and Muktamar, Zainal Variability in growth and yield among sweet corn genotypes grown under organic crop management. IOP Conference Series: Earth and Environmental Science.

Chozin, Mohammad and Hartal, Hartal and guspitasari, y and Sudjatmiko, Sigit The potential use of plant extracts for controlling northern leaf blight on organic sweet corn production. IOP Conference Series: Earth and Environmental Science.

This list was generated on Wed May 25 05:12:19 2022 WIB.