Items where Author is "Ruyani, Aceng"

Up a level
Export as [feed] Atom [feed] EPP RSS 2.0 [feed] RSS 1.0 [feed] RSS 2.0
Group by: Item Type | No Grouping
Number of items: 44.

Febriani, Intan and Rahman, Abdul and Ruyani, Aceng (2019) PENGEMBANGAN LEMBAR KERJA PESERTA DIDIK MATERI KEANEKARAGAMAN HAYATI BERDASARKAN DIVERSITAS IKAN DI SUNGAI AUR LEMAU BENGKULU. Undergraduated thesis, Universitas Bengkulu.

Bella, Anisa and Ruyani, Aceng and Yennita, Yennita (2019) PENGEMBANGAN LEMBAR KERJA PESERTA DIDIK BERBASIS DISCOVERY LEARNING PADA MATERI KEANEKARAGAMAN HAYATI BERDASARKAN KERAGAMAN KURA-KURA SUMATERA DI UNIVERSITAS BENGKULU. Undergraduated thesis, Universitas Bengkulu.

Sari, Intan Indah and Ruyani, Aceng and Ariefa, P yani (2018) PENGEMBANGAN LEMBAR KEGIATAN PESERTA DIDIK (LKPD) SMA MELALUI KEGIATAN INDOOR-OUTDOOR-INDOOR (IOI) UNTUK MENILAI HASIL BELAJAR PADA MATERI IDENTIFIKASI ANCAMAN POPULASI DALAM UPAYA KONSERVASI KURA-KURA. Undergraduated thesis, Universitas Bengkulu.

Trisna, Dwi Martha and Ruyani, Aceng and Yennita, Yennita (2018) PENGEMBANGAN LEMBAR KERJA PESERTA DIDIK MELALUI KEGIATAN INDOOR-OUTDOOR-INDOOR (IOI) PADA MATERI INTERAKSI MAKHLUK HIDUP DENGAN LINGKUNGAN UNTUK MENILAI KECENDERUNGAN BERPERILAKU KONSERVASI KURA�KURA BAGI PESERTA DIDIK SMP (Research and Development). Undergraduated thesis, Universitas Bengkulu.

Isytigfarini, Anisah Putri and Ruyani, Aceng and Yennita, Yennita (2017) UJI KETERBACAAN BOOKLET PADA SISWA SMP BERDASARKAN STUDI KONSUMSI DAN PERTUMBUHAN KURA-KURA NANAS (HEOSEMYS SPINOSA). Undergraduated thesis, Universitas Bengkulu.

Putra, Anggi Rio and Ruyani, Aceng and Haji, Saleh (2014) ELEKTROFORESIS DAN UJI HEMAGLUTINASI LEKTIN BIJI KEBIUL PADA DARAH GOLONGAN ABO DAN IMPLEMENTASI SEBAGAI MODEL PEMBELAJARAN AUDIO-VISUAL UNTUK MENINGKATKAN HASIL BELAJAR KIMIA. Masters thesis, Universitas Bengkulu.

Yulianti , Dessy and Kasrina, Kasrina and Ruyani, Aceng (2014) ETNOBOTANI TUMBUHAN PEKARANGAN SEBAGAI OBAT TRADISIONAL MASYARAKAT SUKU SERAWAI KELURAHAN DUSUN BARU KABUPATEN SELUMA BENGKULU DALAM PENGEMBANGAN SUMBER BELAJAR BIOLOGI SMA. Undergraduated thesis, Universitas Bengkulu.

Sary, Vovy Voesvita and Ruyani, Aceng and Zamzaili , Zamzaili (2014) ISOLASI LEKTIN BUAH JATROPHA MULTIFIDA L DAN UJI AKTIVITAS TERHADAP PROLIFERASI SEL LIMFOSIT MENCIT SERTA IMPLEMENTASINYA PADA PEMBELAJARAN KELOMPOK SAINS DENGAN MENGGUNAKAN MODUL. Masters thesis, Universitas Bengkulu.

Kusrahman, Asep and Zamzaili, Zamzaili and Ruyani, Aceng (2014) ISOLASI, KARAKTERISASI SENYAWA AKTIF DAN UJI FARMAKA EKSTRAK BIJI KEBIUL PADA MENCIT (Mus musculus) SERTA PENERAPANNYA DALAM PEMBELAJARAN KIMIA DI SMAN 1 BENGKULU SELATAN. Masters thesis, Universitas Bengkulu.

Yuniarti, Yuniarti and Ruyani, Aceng and Yani, Ariefa Primair (2014) JENIS-JENIS TUMBUHAN DI PANTAI LAIS KABUPATEN BENGKULU UTARA SEBAGAI MEDIA PADA PEMBELAJARAN BIOLOGI SMA. Undergraduated thesis, Universitas Bengkulu.

Sari , Dian Purnama and Efendi, Rusdi and Ruyani, Aceng (2014) METODE FORWARD CHAINING PADA SISTEM PAKAR UNTUK DIAGNOSA CACAT LAHIR AKIBAT FAKTOR TERATOGEN BERBASIS ANDROID. Undergraduated thesis, Universitas Bengkulu.

Yulisa, Tria and Ruyani, Aceng and Kasrina, Kasrina (2014) PENGARUH EKSTRAK DAUN HONJE (Etlingera hemisphaerica) TERHADAP MORFOLOGI HATI DAN GINJAL MENCIT (Mus musculus) AKIBAT TOKSISITAS MERKURI KLORIDA (HgCl2) SERTA IMPLEMENTASINYA SEBAGAI MEDIA PEMBELAJARAN BIOLOGI SMA. Undergraduated thesis, Universitas Bengkulu.

Simatupang , Melly and Ruyani, Aceng and Abas, Abas (2014) PENGARUH EKSTRAK DAUN HONJE HUTAN (Etlingera hemisphaerica) TERHADAP KUALITAS SPERMA MENCIT (Mus musculus) AKIBAT TOKSISITAS MERKURI KLORIDA SEBAGAI MEDIA BELAJAR BIOLOGI XI IPA 1 SMAN 1 KETAHUN. Undergraduated thesis, Universitas Bengkulu.

Septiawan , Edo and Yennita , Yennita and Ruyani, Aceng (2014) PENGARUH EKSTRAK DAUN SIRIH MERAH (Piper crocatum) TERHADAP PENURUNAN SUHU TUBUH MENCIT (Mus musculus) SEBAGAI MEDIA BELAJAR PADA PEMBELAJARAN BIOLOGI SMA. Undergraduated thesis, Universitas Bengkulu.

Fitriani, Ade and Yennita , Yennita and Ruyani, Aceng (2014) PENGARUH PEMBERIAN PUPUK CAIR LIMBAH ORGANIK TERHADAP PERTUMBUHAN TANAMAN KACANG HIJAU ( PHASEOLUS RADIATUS L.). Undergraduated thesis, Universitas Bengkulu.

Hartati, Yunita and Suhartoyo, Hery and Ruyani, Aceng (2014) PRODUKSI TUNAS TUMBUHAN KEBIUL EKSPLAN ASAL EMBRIO PADA BERBAGAI KOMPOSISI HORMON SECARA IN VITRO DAN IMPLEMENTASINYA SEBAGAI BAHAN LIFE SKILL PADA PEMBELAJARAN BIOLOGI. Masters thesis, Universitas Bengkulu.

Badiaraja , Panji Handoko and Primairyani, Ariefa and Ruyani, Aceng (2014) UJI POTENSI ANTIPIRETIK DAUN MUDA SUNGKAI (PERONEMA CANESCENS) PADA MENCIT (MUS MUSCULUS) SERTA IMPLEMENTASINYA DALAM PEMBELAJARAN SISTEM IMUN DI SMA. Undergraduated thesis, Universitas Bengkulu.

Ruyani, Aceng and Bhakti, Karyadi and Abdul , Kadir and Desiana, Fitri and Rika Yuniar, Tanjung and Yeni, Puspa (2011) ALTERATION OF OSSIFICATION RATE ON FETAL HUMERUS AND FEMUR SWISS WEBSTER MICE (Mus muculus) AS THE TERATOGENIC EFFECTS OF GADUNG (Dioscorea hispida Dennts). Medika, 37 (9). pp. 596-603. ISSN 0126-0901

Ruyani, Aceng (2011) PETANDA OLIGONULEOTIDA (ACTTAATTGGGAGCCATATA) BERLABEL BIOTIN UNTUK DETEKSI DINI KELAINAN GENETIK SPINDYLO-EPIPHYSEAL DYSPLASIA TARDA (SEDT) DI BENGKULU. Universitas Bengkulu, Bengkulu.

Ruyani, Aceng (2010) BAB I. PENDAHULUAN. In: MODEL TERATOPROTEOMIK, PENERAPAN TEKNIK ANALISIS PROTEIN DALAM PENELITIAN BIDANG TOKSIKOLOGI PERKEMBANGAN. UNIB PRESS, Bengkulu, pp. 1-7. ISBN 978-979-9431-45-5

Ruyani, Aceng and J, Jeyabalan and PT, Christie and Bhakti, Karyadi and Choirul, Muslim and Sipriyadi, Sipriyadi and Suherlan, Suherlan and RV, Thakker (2010) Characterisation of mutation of the SEDL (TRAPPC2) gene in patiens with X-linked spondyloepiphyseal dysplasia tarda from a region of Indonesia. In: Seminar Hasil PAR, 5 Oktober 2010, Hotel Millenium Jakarta.

Ruyani, Aceng (2010) Integrating the Message of Turtle Conservation into a Science Teaching Plan for Elementary School in Bengkulu City, Indonesia. Asian Turtle Conservation Network.

Ruyani, Aceng and Agus, Sundaryono and Dewi, Handayani and Sipriyadi, Sipriyadi (2010) LAPORAN PENELITIAN UNGGULAN : PENGEMBANGAN POTENSI KULIT BATANG GAHARU (Aquilaria malaccensis) SEBAGAI PENAMBAH KEBUGARAN SEKSUAL MELALUI UJI FERTILITAS DAN TERATOGENESIS EKSTRAK STEROID PADA MENCIT (Mus muculus). Project Report. Lembaga Penelitian Universitas Bengkulu, Bengkulu.

Ruyani, Aceng and Agus, Sundaryono and Hery, Haryanto (2010) LAPORAN PENELITIAN UNGGULAN UNIB : PENGEMBANGAN TUMBUHAN BETADIN (Jatropa multifida L) UNTUK MENINGKATKAN JUMLAH TROMBOSIT (Keping darah) PADA PENDERITA PENYAKIT DEMAM BERDARAH DENGUE. Project Report. Lembaga Penelitian Universitas Bengkulu, Bengkulu.

Ruyani, Aceng and Bhakti, Karyadi and Choirul, Muslim and Suherlan, Suherlan (2009) ANALISIS ANATOMI VERTEBRAE DAN DISKUS INETRVETERALIS BAGIAN LUMBAL PADA PENYANDANG PERAWAKAN PENDEK (SPONDYLO EPIPHYSEAL DYSPLASIA TARDA, SEDT) DIRSUD M. YUNUS BENGKULU. In: Seminar Nasional Biologi, Ilmu Lingkungan, dan Pembelajarannya, 4 Juli 2009, Universitas Negeri Yogyakarta.

Ruyani, Aceng (2009) TOPIK PILIHAN BIOLOGI : PERKEMBANGAN HEWAN. In: TOPIK PILIHAN BIOLOGI : PERKEMBANGAN HEWAN. UNIB PRESS, Bengkulu, pp. 1-7. ISBN 978-9799431-49-3

Ruyani, Aceng and Bhakti, Karyadi and Rina, Elvia (2008) LAPORAN PENELITIAN : PENGEMBANGAN BAHAN AJAR CAL BIOLOGI PERKEMBANGAN HEWAN UNTUK MENINGKATKAN PEMAHAMAN MAHASISWA TENTANG TANGGUNG JAWAB SOSIAL. Project Report. Lembaga Penelitian Universitas Bengkulu, Bengkulu.

Ruyani, Aceng and Agus, Sundaryono (2008) LAPORAN PENELITIAN UNGGULAN : PENGEMBANGAN POTENSI KULIT BATANG GAHARU (Aquilaria malaccensis) SEABAGAI PERANGSANG SEKS (Aphriodisiac) di Provinsi Bengkulu. Project Report. Lembaga Penelitian Universitas Bengkulu, Bengkulu.

Ruyani, Aceng (2008) PEMELIHARAAN HERPETOFAUNA LANGKA (Monouria emys DAN Heosemys spinosa) SEBAGAI SUMBER BELAJAR KONSERVASI EX SITU DI KEBUN BIOLOGI UNIVERSITAS BENGKULU. In: WORKSHOP BAGI DOSEN DAN MAHASISWA TENTANG PEMELIHARAAN HERFETOFAUNA LANGKA SEBAGAI SUMBER BELAJAR KONSERVASI EX SITU, 1 Desember 2008, Bengkulu.

Ruyani, Aceng and Bhakti, Karyadi and Eka, Novianti (2007) STUDI ANATOMI ORGAN REPRODUKSI KURA-KURA GARIS HITAM (Cyclemis oldhamii) DAN KURA-KURA PATAH DADA (Cuora amboinensis). In: Seminar Herpetologi Indonesia, 26-27 Mei 2007, Bogor.

Novieta, Yuyun and Ruyani, Aceng and Tarigan, Hendri (2007) DEPARTEMEN PENDIDIKAN NASIONAL SEBARAN KURA-KURA AIR TAWAR DAN KURA-KURA TERESTERIAL DI KABUPATEN BENGKULU UTARA. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Malvianti, Rini and Ruyani, Aceng and Tarigan, Hendri (2007) INVENTARISASI DAN SEBARAN KURA-KURA AIR TAWAR DAN TERESTERIAL DI KABUPATEN BENGKULU SELATAN. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Peasari, Wita and Tarigan, Hendri and Ruyani, Aceng (2007) INVENTARISASI, SEBARAN, DAN DOMINANSI JENIS-JENIS LOBSTER DI PERAIRAN PULAU TIKUS BENGKULU. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Zermansyah, Zermansyah and Sundaryono, Agus and Ruyani, Aceng (2007) ISOLASI SENYAWA FLAVONOID FRAKSI POLAR DARI AUN GAHARU (A quil laria m alac ce ns is ) DAN UJI ANTIMALARIA PADA MENCIT (M us mu sc ulu s) SWISS WEBSTER JANTAN. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Yustiana, Eli and Tarigan, Hendri and Ruyani, Aceng (2007) KOMPOSISI SPESIES DAN MORFOMETRIK IKAN KERAPU (SERRANIDAE ) YANG DI DARATKAN DI KABUPATEN KAUR. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Ruyani, Aceng and Choirul, Muslim and Bhakti, Karyadi and H., Suherlan (2007) LAPORAN PENELITIAN HIBAH BERSAING : IDENTIFIKASI ANATOMI DAN MOLEKULER ANAK-ANAK CEBOL SEDT (SPOHDYLO-EPIPHYSEAL DYSPLASIA TARDA) SERTA UPAYA PENINGKATAN KELAYAKAN HIDUPNYA DI KEDURANG BENGKULU SELATAN. Project Report. Lembaga Penelitian Universitas Bengkulu, Bengkulu.

Malinda, Efri and Ruyani, Aceng and Karyadi, Bhakti (2007) PEMBERIAN RASIO KUBIS PUTIH (Brassica oleracea) DAN RUCAH AYAM SEBAGAI PAKAN SERTA PENGARUHNYA TERHADAP PERTUMBUHAN KURA-KURA GARIS HITAM (Cyclemys oldhamii). Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Yufitri, Rosianti and Ruyani, Aceng and Karyadi, Bhakti (2007) PENGARUH PERBANDINGAN PAKAN RUCAH IKAN DAN USUS AYAM TERHADAP PERTUMBUHAN LABI-LABI HUTAN (Dogonia subplana). Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Fitri, Yunia and Ruyani, Aceng and Tarigan, Hendri (2007) PENYEBARAN KURA-KURA BERDASARKAN HABITAT SUNGAI DAN RAWA DI HUTAN SUAKA ALAM PASAR NGALAM, AIR PERIUKAN, KABUPATEN SELUMA. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Puspitasari, Rita and Ruyani, Aceng and Tarigan, Hendri (2007) SEBARAN KURA-KURA AIR TAWAR DAN KURA-KURA TERRESTRIAL DI KABUPATEN KEPAHIANG BENGKULU. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Ruyani, Aceng and Choirul, Muslim and Bhakti, Karyadi and H., Suherlan (2007) STUDI POPULASI PENYANDANG PERAWAKAN PENDEK BERPAUT KROMOSOM X (SPONDYLO EPIPHYSEAL DYSPLASIA TARDA, SEDT) DI WILAYAH KEDURANG BENGKULU SELATAN. In: Seminar Pemantauan Hasil Penelitian Hibah Bersaing, 17-19 Desember 2007, Jakarta.

Maita, Severlina and Karyadi, Bhakti and Ruyani , Aceng (2007) STUDI VARIASI MORFOLOGI BAGIAN KARAPAKS DAN PLASTRON PADA BEBERAPA JENIS KURA-KURA DI BENGKULU. Undergraduated thesis, Fakultas Keguruan dan Ilmu Pendidikan UNIB.

Ruyani, Aceng and Sri, Sudarwati and Lien A., Sutasurya and Sony H., Sumarsono and Dong-Jo, Kim and Jun Ho, Chung (2005) A teratoproteomics analysis: heat shock protein 70 is upregulated in mouse forelimb bud by methoxyacetic acid treatment. Wiley InterScience, 73. pp. 517-521.

Ruyani, Aceng and Sudarwati, S and Sutasurya, Sutasurya and Sumarsono , SH and Gloe, T (2003) The laminin binding protein p40 is involved in inducing limb abnormality of mouse fetuses as the effects of methoxyacetic acid treatment. Toxicol Sci., 75 (1). pp. 148-153.

This list was generated on Fri Apr 19 13:07:18 2024 WIB.